Multiple signaling pathways could be implicated in SIRT2\HNF4\mediated regulation of fatty liver diseases and related metabolic disorders. SIRT2 liver\specific ablation exacerbated these metabolic dysfunctions in HFD\fed C57BL/6J mice. Mechanistically, SIRT2 stabilized the hepatocyte nuclear factor 4 (HNF4) protein by binding to and deacetylating HNF4 on lysine 458. Furthermore, HNF4 was sufficient to mediate SIRT2 function, and SIRT2\HNF4 interaction was required for SIRT2 function both and and housed in a temperature\controlled environment (23??2C) with a 12/12\hour light/dark cycle. Male C57BL/6 and obese (ob/ob) mice aged 7\8?weeks were purchased from the Model Animal Research Center of Nanjing University (Nanjing, China). Mice were maintained with either a normal chow diet (NCD; 10?kcal% fat, 70?kcal% carbohydrate, and 20?kcal% protein; Beijing Huafukang Bioscience Co., Ltd.) or a high\fat diet (HFD; D12492; Research Diets; 60?kcal% fat, 20?kcal% carbohydrate, and 20?kcal% protein; Beijing Huafukang Bioscience Co., Ltd.) for 12?weeks. Histological Analysis Hematoxylin and eosin (H&E) staining was performed to visualize lipid accumulation patterns in liver tissues. Lipid droplet accumulation in the liver was analyzed by oil red O (ORO) staining of frozen liver sections. Periodic acid\Schiff (PAS) staining was performed to determine the glycogen content of liver tissues using paraffin\prepared liver sections. Metabolic Assays Glucose tolerance tests (GTTs) and insulin tolerance tests (ITTs) were performed by i.p. injection of 1 1?g/kg glucose (Sigma\Aldrich Co., St. Louis, MO) and 0.75 U/kg insulin (Novolin R; Novo Nordisk Co., Bagsvaerd, Denmark) into mice after 6\hour fasting. Blood glucose levels were detected at 0, 15, 30, 60, and 120?minutes after injection. Fasting blood glucose (FBG) and fasting serum insulin (FINS) levels were examined in tail blood every 2?weeks using a glucometer (One Touch Ultra Easy; Life Scan) and ELISA (Millipore, Billerica, MA), respectively. Homeostasis model of assessment of the insulin resistance index (HOMA\IR) was calculated using the following equation: [fasting blood glucose (mmol/L) fasting serum insulin (mIU/L)]/22.5. AUCs were calculated to reflect glucose and insulin tolerance levels. Biochemistry Assay Liver and serum lipid contents were determined using commercial kits for triglyceride (TG), total cholesterol (TC), and nonesterified fatty acid (NEFA). Liver function was evaluated in the animals by measuring the serum concentrations of alanine aminotransferase (ALT), aspartate aminotransferase (AST), and alkaline phosphatase (ALP) using commercial kits. Cell Culture, Treatment, and Transfection HCC HepG2 and human embryonic kidney (HEK) 293T cells were purchased from the American Type Culture Collection (Manassas, VA), and cultured in DMEM (Gibco; 10569044) supplemented with 10% fetal bovine serum (Gibco; 16140071), 100?IU/mL penicillin, and 100?g/mL streptomycin. Cells maintained in a 37C incubator with 5% CO2 and grown to 70%\90% confluence were collected for analyses unless otherwise noted. To establish an model of lipid accumulation in HepG2 cells, they were treated with 0.5?mM palmitate (PA) for 24?hours. For SIRT2 inhibitor treatments, HepG2 cells were supplemented with 10?M acylglycerol kinase 2 for 24?hours or with DMSO as a control. Transient transfections were performed using Lipofectamine 2000 (Invitrogen/Life Technologies; 11668019) according to the manufacturers instructions. All small interfering RNAs (siRNAs) were produced by RiboBio (Guangdong, China). siRNA target sequences were as follows: SIRT2, 5\CCTGCTCATCAACAAGGAGAA\3 and 5\CCTGCTCATCAACAAGGAGAA\3; HNF4, 5\GATCAGCACTCGAAGGTCAA\3. Endogenous or exogenous HNF4 protein degradation was analyzed using a protein stability assay. Briefly, HepG2 cells transfected with si\Ctrl (control) or si\SIRT2 for 48?hours were incubated with 20?M MG132 or 100?g/mL cycloheximide (CHX) for the indicated FUT3 time points. HNF4 protein levels were analyzed by western blotting. Protein Interaction Analysis Protein interactions associated with biological processes related to lipid metabolism were identified using the online STRING database (https://string\db.org/). ( 16 ) Details of real\time quantitative PCR, western blotting, plasmid constructs, immunoprecipitation (IP), and immunofluorescence are shown in the Supporting Information. Statistical Analysis Statistical analysis was performed using SPSS NU6300 software (version 19.0), and all NU6300 data are presented as means??standard deviations. A two\tailed Student test was performed to compare data of the two groups with a normal distribution. For multiple comparisons, one\way ANOVA with Tukeys analysis was NU6300 applied. Nonparametric statistical analysis was performed using the Kruskal\Wallis test, followed by Dunns test for multiple comparisons. values are represented as follows: # test. All results are representative of three independent experiments. Hepatic SIRT2 expression in genetically obese ob/ob and HFD\fed mice and PA\induced HepG2 cells was examined. In both ob/ob.