Briefly, Lin-gp38+ cells were seeded in 96-well plates (5,000 cells/well), and stimulated with 10 ng/mL TGF- for 24 h. and gp38 (known also as podoplanin). Fibroblasts were defined in a two-color flow cytometry analysis as a lineage-negative (Lin: Ter119?CD45?CD31?) and gp38-positive (gp38+) populace. Analysis of hearts isolated from Col1a1-EGFP reporter mice showed that cardiac Lin?gp38+ cells corresponded to type I collagen-producing cells. Lin?gp38+ cells were partially positive for the mesenchymal markers CD44, CD140a, Sca-1 and CD90.2. Sorted Lin?gp38+ cells were successfully expanded for up MCLA (hydrochloride) to four passages. Lin?gp38+ cells activated by Transforming Growth Factor Beta 1 (TGF-1) upregulated myofibroblast-specific genes and proteins, developed stress fibers positive for alpha easy muscle actin (SMA) and MCLA (hydrochloride) showed increased contractility in the collagen gel contraction assay. Conclusions: Two-color flow cytometry analysis using the selected cell surface antigens allows for the identification of collagen-producing fibroblasts in unaffected mouse hearts without using specific reporter constructs. This strategy opens new perspectives to study the physiology and pathophysiology of cardiac fibroblasts in mouse models. oligonucleotides: forward (5->3): CGCTGTCAGGAACCCTGAGA, reverse (5->3): CGAAGCCGGCCTTACAGA; (housekeeping gene) oligonucleotides: forward (5->3): CTGCACCACCAACTGCTTAGC, reverse (5->3): GGCATGGACTGTGGTCATGAG. Relative expression was normalized to levels. Western Blotting Cellular proteins were extracted with RIPA buffer (Sigma-Aldrich) supplemented with protease inhibitor cocktail (Complete ULTRA Tablets, Roche) and phosphatase inhibitors (PhosphoStop, Roche) from cultivated cells. Protein concentration was quantified by colorimetric bicinchoninic acid assay according to the manufacturer’s protocol (Thermo Fisher Scientific). SDS-PAGE electrophoresis and MCLA (hydrochloride) wet-transfer method were used to separate and transfer proteins on nitrocellulose membranes followed by 45 min incubation in blocking answer: [tris buffered saline, Tween-20 (TBST, Thermo Fisher Scientific) made up of 5% skim milk powder (Becton Dickinson AG)]. Membranes were incubated overnight with the following primary antibodies: anti-SMA (1:1000, clone 1A4, Sigma-Aldrich) or GAPDH (1:10000, clone 14C10, Cell Signaling). Horseradish peroxidase (HRP)-conjugated secondary antibodies were used for detection with ECL substrate (SuperSignal West Pico Plus, Thermo Fisher Scientific) and development around the Fusion Fx (Vilber). Densitometric analyses were performed with ImageJ 1.47t. Fold changes were computed after normalization to GAPDH. ELISA Lin?gp38+ cells were cultured for up to 4 passages and seeded with or without TGF-1 (10 ng/mL) in 1% FBS medium for 7 days. Supernatants were collected and diluted 1:100 for assessing the amount of pro-collagen I alpha 1 using ELISA (Abcam) according to the manufacturer’s instructions. The amount of pro-collagen I alpha 1 in the samples was calculated as interpolation of the standard curve. Immunofluorescent Staining Cells Cells were seeded in 8-chamber slides (Lab-Tec) at the density of 2,500 cells/well, fixed in ice-cold methanol:acetone 7:3 (both Sigma-Aldrich) for 10 min at ?20C, washed with PBS and blocked with 10% FBS in PBS for 20 min at room temperature. Subsequently, incubation with the primary mouse anti-SMA antibody (clone: clone 1A4, 1:100, Sigma-Aldrich) was performed for 1 h at room temperature followed by staining with the secondary Alexa 488 goat anti-mouse antibody RGS17 (1:400, Thermo Fischer Scientific) and 50 g/ml of fluorescent labeled phalloidin (Sigma-Aldrich) to visualize stress fibers for 45 min at room temperature. Nuclei were counterstained with DAPI answer (1 g/ml, Roche). Images were acquired with an Olympus BX53 microscope equipped with a DP80 camera. Heart Tissue Hearts were collected after PBS perfusion through the left ventricle, washed in cold PBS and incubated 24 h in 4% paraformaldehyde-PBS followed by incubating for another 24 h in 30% Sucrose-PBS at 4C. Tissues were embedded in OCT and 15 m sections were cut and kept in PBS at 4C until used for immunohistochemical staining. First, cardiac sections were permeabilized with 0.1% TritonX-100 (Sigma-Aldrich) in PBS for 5 min, washed 3 times in PBS.